ID: 1002715739_1002715751

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002715739 1002715751
Species Human (GRCh38) Human (GRCh38)
Location 5:181225822-181225844 5:181225868-181225890
Sequence CCAGCACAAATAGCACTACTTAG CAGTGGGACCAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78} {0: 1, 1: 0, 2: 5, 3: 103, 4: 775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!