ID: 1002948150_1002948154

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1002948150 1002948154
Species Human (GRCh38) Human (GRCh38)
Location 6:1782220-1782242 6:1782265-1782287
Sequence CCCAGTTACATGTATTTAAAAAG AAACCAATAAGCCTAAACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 490} {0: 1, 1: 0, 2: 0, 3: 24, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!