ID: 1003050242_1003050248

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1003050242 1003050248
Species Human (GRCh38) Human (GRCh38)
Location 6:2774048-2774070 6:2774083-2774105
Sequence CCTTTTGTGCCATTGAATAGAAA AACTCCAGAATACAAGGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 324} {0: 1, 1: 0, 2: 0, 3: 11, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!