ID: 1003050642_1003050649

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1003050642 1003050649
Species Human (GRCh38) Human (GRCh38)
Location 6:2777969-2777991 6:2778009-2778031
Sequence CCACAAGGAATAACTGGAAATCA GGTGAGATGAGGCATCTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 224} {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!