ID: 1003087132_1003087144

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1003087132 1003087144
Species Human (GRCh38) Human (GRCh38)
Location 6:3068948-3068970 6:3068975-3068997
Sequence CCCGCCGGTACCGGAAGTCGGGC GGCGGGGCCGCGGGCGCTCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 60, 4: 581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!