ID: 1003094586_1003094600

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1003094586 1003094600
Species Human (GRCh38) Human (GRCh38)
Location 6:3132332-3132354 6:3132383-3132405
Sequence CCCGACTTCCCTCCTCTCTCAGG CCCCATGTGGGCCACAGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 46, 4: 494} {0: 1, 1: 0, 2: 1, 3: 13, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!