ID: 1003117781_1003117785

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1003117781 1003117785
Species Human (GRCh38) Human (GRCh38)
Location 6:3294894-3294916 6:3294915-3294937
Sequence CCAAGGTTAGGATGTACTGATGG GGGGCAGTGAGCAGCCCCACTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 25, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!