ID: 1003123920_1003123928

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1003123920 1003123928
Species Human (GRCh38) Human (GRCh38)
Location 6:3340107-3340129 6:3340127-3340149
Sequence CCACAAAAGCGGTATTATCCAGG AGGAGGGATGGCCTGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} {0: 1, 1: 1, 2: 3, 3: 50, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!