ID: 1003306043_1003306048

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1003306043 1003306048
Species Human (GRCh38) Human (GRCh38)
Location 6:4930441-4930463 6:4930458-4930480
Sequence CCCTGCACCTGCACTGTGGCAGC GGCAGCTGCTTTCGGTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 295} {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!