ID: 1003317852_1003317866

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1003317852 1003317866
Species Human (GRCh38) Human (GRCh38)
Location 6:5027829-5027851 6:5027861-5027883
Sequence CCTTTCCCTTTCAGGGTGCTTAA GCTGGTGGAGGGCTGGGCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!