ID: 1003317854_1003317868

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1003317854 1003317868
Species Human (GRCh38) Human (GRCh38)
Location 6:5027835-5027857 6:5027875-5027897
Sequence CCTTTCAGGGTGCTTAAGTGCCC GGGCACAGGAGAGAGGCAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!