ID: 1003343971_1003343982

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1003343971 1003343982
Species Human (GRCh38) Human (GRCh38)
Location 6:5248257-5248279 6:5248309-5248331
Sequence CCAGTCCCCTTCTCCCTGTGCTG CATCTGAGTAAACTCAACTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!