ID: 1003378871_1003378873

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1003378871 1003378873
Species Human (GRCh38) Human (GRCh38)
Location 6:5604260-5604282 6:5604273-5604295
Sequence CCAGGTCTGCCACACTCCCATCT ACTCCCATCTACACTCCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 88, 4: 404} {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!