ID: 1003392077_1003392083

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1003392077 1003392083
Species Human (GRCh38) Human (GRCh38)
Location 6:5723015-5723037 6:5723043-5723065
Sequence CCCTGAGAGAGGGCAGGCAGGAG GTTGGGGAAGACTCCACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 523} {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!