ID: 1003396149_1003396152

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1003396149 1003396152
Species Human (GRCh38) Human (GRCh38)
Location 6:5753794-5753816 6:5753825-5753847
Sequence CCATTAAAACTTCTCATAGTTTT GTGGCAGTCCAGCACCATGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!