ID: 1003397244_1003397250

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1003397244 1003397250
Species Human (GRCh38) Human (GRCh38)
Location 6:5763933-5763955 6:5763952-5763974
Sequence CCCATCCTCAGTCCAAAGTCAGA CAGAGTCCAAACTCTGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!