ID: 1003556049_1003556065

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003556049 1003556065
Species Human (GRCh38) Human (GRCh38)
Location 6:7141166-7141188 6:7141211-7141233
Sequence CCGGTGAGCGGGTAGCGAGGCCA ATTGGCTGGCGGGCTGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67} {0: 1, 1: 0, 2: 0, 3: 37, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!