ID: 1003564205_1003564207

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1003564205 1003564207
Species Human (GRCh38) Human (GRCh38)
Location 6:7208677-7208699 6:7208696-7208718
Sequence CCAGACTAAGCCAGAGGCTCTGC CTGCAGTCCTTGAGCAAAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!