ID: 1003605225_1003605233

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1003605225 1003605233
Species Human (GRCh38) Human (GRCh38)
Location 6:7553798-7553820 6:7553828-7553850
Sequence CCCCTGGGCCTGCCTGGAGGAGC TTCTTCTGGGAGTAGTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 46, 4: 421} {0: 1, 1: 1, 2: 1, 3: 8, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!