ID: 1003630771_1003630780

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003630771 1003630780
Species Human (GRCh38) Human (GRCh38)
Location 6:7784832-7784854 6:7784885-7784907
Sequence CCTTCTACCTTGGGATTGCACAG TACGCTGAGGAAGTGAAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!