ID: 1003642729_1003642731

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1003642729 1003642731
Species Human (GRCh38) Human (GRCh38)
Location 6:7888945-7888967 6:7888972-7888994
Sequence CCAGATGTCTTAGCGGTGGTGCA CTGCATGTTCATATTTAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} {0: 1, 1: 0, 2: 2, 3: 26, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!