ID: 1003663175_1003663178

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1003663175 1003663178
Species Human (GRCh38) Human (GRCh38)
Location 6:8083989-8084011 6:8084022-8084044
Sequence CCTTGAGAAGGTGTTTATTTCTC GCCTGCACTTGGACTAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 292} {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!