ID: 1003819085_1003819096

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1003819085 1003819096
Species Human (GRCh38) Human (GRCh38)
Location 6:9876007-9876029 6:9876059-9876081
Sequence CCCTAACCTCCAATGCAGTCGTA AGGTTTAGATGAGATCATGAGGG
Strand - +
Off-target summary No data {0: 17, 1: 128, 2: 306, 3: 545, 4: 1144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!