ID: 1003892512_1003892514

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1003892512 1003892514
Species Human (GRCh38) Human (GRCh38)
Location 6:10576020-10576042 6:10576038-10576060
Sequence CCTGTTTGGTGGTCTCTTCACAC CACACGGACGTGCATGAAAACGG
Strand - +
Off-target summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130} {0: 1, 1: 3, 2: 12, 3: 26, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!