ID: 1003897829_1003897832

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1003897829 1003897832
Species Human (GRCh38) Human (GRCh38)
Location 6:10624246-10624268 6:10624286-10624308
Sequence CCCAAGACTGGGTAATTTATAAA GACTCACAGTTCCACGTGACTGG
Strand - +
Off-target summary {0: 2548, 1: 10465, 2: 14335, 3: 13164, 4: 9470} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!