ID: 1003940411_1003940418

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1003940411 1003940418
Species Human (GRCh38) Human (GRCh38)
Location 6:11019609-11019631 6:11019647-11019669
Sequence CCACACATCAAACTGTTAACAGT GGCAAGGAGGATAGTGGGCATGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 3, 3: 28, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!