ID: 1003977784_1003977790

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1003977784 1003977790
Species Human (GRCh38) Human (GRCh38)
Location 6:11360217-11360239 6:11360235-11360257
Sequence CCCCCATTAGGGTGAAGAGGGTG GGGTGTGACATATGAGGAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!