ID: 1004149830_1004149833

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1004149830 1004149833
Species Human (GRCh38) Human (GRCh38)
Location 6:13105697-13105719 6:13105722-13105744
Sequence CCAGAAGGACTCACAGAACTCAG AAGCACTTACACCTAATTAAAGG
Strand - +
Off-target summary {0: 3, 1: 12, 2: 18, 3: 79, 4: 280} {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!