ID: 1004167440_1004167445

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1004167440 1004167445
Species Human (GRCh38) Human (GRCh38)
Location 6:13269454-13269476 6:13269479-13269501
Sequence CCCCTAATATTGTGAATTTCCAA ACACAGCTGGCCCTTGTCAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!