ID: 1004305608_1004305615

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1004305608 1004305615
Species Human (GRCh38) Human (GRCh38)
Location 6:14499374-14499396 6:14499408-14499430
Sequence CCTCCCACCTTGGCCTTACAAAG CAGGCGTAAGCCACCACACCTGG
Strand - +
Off-target summary No data {0: 224, 1: 6834, 2: 39826, 3: 122873, 4: 212164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!