|
Left Crispr |
Right Crispr |
Crispr ID |
1004305608 |
1004305615 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:14499374-14499396
|
6:14499408-14499430
|
Sequence |
CCTCCCACCTTGGCCTTACAAAG |
CAGGCGTAAGCCACCACACCTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 224, 1: 6834, 2: 39826, 3: 122873, 4: 212164} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|