ID: 1004399161_1004399166

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1004399161 1004399166
Species Human (GRCh38) Human (GRCh38)
Location 6:15272570-15272592 6:15272589-15272611
Sequence CCAAATTGCAGCTGTGGAAACAA ACAAAGCAGGTAAAGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 341} {0: 1, 1: 0, 2: 2, 3: 54, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!