ID: 1004441501_1004441503

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1004441501 1004441503
Species Human (GRCh38) Human (GRCh38)
Location 6:15659501-15659523 6:15659523-15659545
Sequence CCAGGGCCATGTTTTTTCATTTT TTTCTTTCTTTTTTAAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 1174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!