ID: 1004540386_1004540392

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1004540386 1004540392
Species Human (GRCh38) Human (GRCh38)
Location 6:16544249-16544271 6:16544275-16544297
Sequence CCTTCCTTGCATTGTTCCCACAG CCAGAGCCAGCTGTCCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 228} {0: 1, 1: 1, 2: 2, 3: 41, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!