ID: 1004545058_1004545061

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1004545058 1004545061
Species Human (GRCh38) Human (GRCh38)
Location 6:16589706-16589728 6:16589737-16589759
Sequence CCATTATCACTATCAGTATTGTT TAAGCTGAATTTACAACTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!