ID: 1004549768_1004549773

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1004549768 1004549773
Species Human (GRCh38) Human (GRCh38)
Location 6:16635766-16635788 6:16635787-16635809
Sequence CCAGAAGCATCCAAAAGCATCCT CTGAAAACATGAGTGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207} {0: 1, 1: 2, 2: 3, 3: 29, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!