ID: 1004642972_1004642974

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1004642972 1004642974
Species Human (GRCh38) Human (GRCh38)
Location 6:17533264-17533286 6:17533307-17533329
Sequence CCTTCCACACACTGCATATTGGT GTTCATATATTTAAAAATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 244} {0: 1, 1: 0, 2: 4, 3: 69, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!