ID: 1004673270_1004673273

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1004673270 1004673273
Species Human (GRCh38) Human (GRCh38)
Location 6:17817135-17817157 6:17817150-17817172
Sequence CCAGTTCCCGCTCATACATGAGC ACATGAGCCGCTGCTCCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43} {0: 1, 1: 0, 2: 2, 3: 18, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!