ID: 1004679691_1004679696

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1004679691 1004679696
Species Human (GRCh38) Human (GRCh38)
Location 6:17881128-17881150 6:17881162-17881184
Sequence CCTTCTCAGAATCCCACTCCTTC CAACTTATAAAACTCATACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 316} {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!