ID: 1004684594_1004684605

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1004684594 1004684605
Species Human (GRCh38) Human (GRCh38)
Location 6:17930628-17930650 6:17930679-17930701
Sequence CCACACTTTGCCATAACCTTCCC AGTTTCCACAATAGACCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 240} {0: 1, 1: 0, 2: 2, 3: 45, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!