ID: 1004720589_1004720593

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1004720589 1004720593
Species Human (GRCh38) Human (GRCh38)
Location 6:18264685-18264707 6:18264700-18264722
Sequence CCGCGGGCGGAGGGATGCGCGCG TGCGCGCGCGGGGCTCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189} {0: 1, 1: 0, 2: 3, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!