ID: 1004891859_1004891863

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1004891859 1004891863
Species Human (GRCh38) Human (GRCh38)
Location 6:20108588-20108610 6:20108606-20108628
Sequence CCCTCCATCGGCTATAGGGAATT GAATTCCCAACTTAGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!