ID: 1004924517_1004924532

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1004924517 1004924532
Species Human (GRCh38) Human (GRCh38)
Location 6:20403818-20403840 6:20403859-20403881
Sequence CCCTTACAGCAGCAGGTTAGTGA CGCCGACGCCGCGGGGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106} {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!