ID: 1004991022_1004991027

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1004991022 1004991027
Species Human (GRCh38) Human (GRCh38)
Location 6:21138898-21138920 6:21138918-21138940
Sequence CCTTTCTCCTTCTGTGTGCCCTT CTTCTTGCTGCTTATGGACTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 63, 4: 720} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!