ID: 1005054764_1005054766

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1005054764 1005054766
Species Human (GRCh38) Human (GRCh38)
Location 6:21719226-21719248 6:21719247-21719269
Sequence CCTTCCAGTTCTGGAGGGAAGAA AAGTCCAAAATCAGTGTCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!