ID: 1005144674_1005144677

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1005144674 1005144677
Species Human (GRCh38) Human (GRCh38)
Location 6:22675179-22675201 6:22675211-22675233
Sequence CCGTATTCCAAAGATACCTGCAC CATTGAAGCATTATTCATAATGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 90, 3: 345, 4: 918}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!