ID: 1005339373_1005339380

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1005339373 1005339380
Species Human (GRCh38) Human (GRCh38)
Location 6:24829139-24829161 6:24829188-24829210
Sequence CCTGTTTCTACTAAAAATATAAA CTGTAATCACAGCTACTGGGTGG
Strand - +
Off-target summary {0: 221, 1: 13068, 2: 192200, 3: 221605, 4: 128329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!