ID: 1005389276_1005389279

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1005389276 1005389279
Species Human (GRCh38) Human (GRCh38)
Location 6:25316970-25316992 6:25317022-25317044
Sequence CCTTAGTTTTTAACTGGGAAGTT ACTACAATTTTAAAACTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!