ID: 1005423129_1005423139

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1005423129 1005423139
Species Human (GRCh38) Human (GRCh38)
Location 6:25673307-25673329 6:25673324-25673346
Sequence CCCCCTTAAACCAGACCCTCCAG CTCCAGGGCAGAATCAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160} {0: 1, 1: 0, 2: 1, 3: 23, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!