ID: 1005445798_1005445808

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1005445798 1005445808
Species Human (GRCh38) Human (GRCh38)
Location 6:25921351-25921373 6:25921397-25921419
Sequence CCATAGTTGATGGAGCTAAAGAT ATTGATACACAGAGGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151} {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!