ID: 1005456186_1005456191

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1005456186 1005456191
Species Human (GRCh38) Human (GRCh38)
Location 6:26021794-26021816 6:26021826-26021848
Sequence CCCGGCGTGGCGGTGTGAAGCGG CTGATCTACGAGGAGACTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 1296} {0: 1, 1: 3, 2: 3, 3: 9, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!